licT [2018-02-10T14:30:04.000Z]

transcriptional antiterminator of the bglP-bglH-yxiE operon and the bglS gene

Locus: BSU39080

Isoelectric point: 5.94

Molecular weight: 32.22 kDa

Protein length: 277 aa

Gene length: 831 bp

Function: control of beta-glucan and beta-glucoside utilization

Product: transcriptional antiterminator (BglG family)

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of beta-glucosides
• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of other polymeric carbohydrates
• Information processing → Regulation of gene expression → Transcription factors and their control → PRD-type regulators
• Information processing → Regulation of gene expression → RNA binding regulators
• Groups of genes → Phosphoproteins → Phosphorylation on a His residue

Gene

Coordinates: 4,012,866 → 4,013,699

Phenotypes of a mutant

• no expression of the bglP-bglH operon

The protein

Catalyzed reaction/ biological activity

• binding to the mRNAs of bglS and the bglP-bglH operon, causes transcription antitermination (in presence of salicin and absence of glucose)

Protein family

• BglG family of antiterminators (according to Swiss-Prot)

Paralogous protein(s)

• SacY, GlcT, SacT

Domains

• N-terminal RNA binding domain PubMed
• 2 x PRD (PTS regulation domains) PubMed

Modification

• phosphorylation at His-100 in PRD-1 by phosphorylated BglP, inhibits LicT antitermination activity
• phosphorylation at His-207 and/or His-269 in PRD-2 by His-P-HPr, stimulates LicT antitermination activity

Structure

• 1L1C (complex with RAT)
• 1TLV (PRDs)

Localization

• cytoplasm, even distribution in the absence of the inducer salicin, subpolar localization in the presence of salicin PubMed

Additional information

• information on binding sites can be found in the PRODORIC2 database

Expression and Regulation

Operons

• Genes: licT-bglS
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulation

  • expressed in the stationary phase (temporal activation) PubMed

• Genes: yxiP-licT-bglS
  Description: PubMed

Biological materials

Mutant

• GP427 (ΔlicT-bglS::erm), available in Jörg Stülke's lab
• BKE39080 (ΔlicT::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGGCATGTCCCTCCAAAT, downstream forward: _UP4_TAATGAGAGCGCTGACATTT
• BKK39080 (ΔlicT::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGGCATGTCCCTCCAAAT, downstream forward: _UP4_TAATGAGAGCGCTGACATTT

Expression vector

• for expression, purification of both PRDs in E. coli with N-terminal His-tag, in pWH844: pGP165, available in Jörg Stülke's lab
• for expression, purification of the RNA-binding domain in E. coli with N-terminal His-tag, in pWH844: pGP315, available in Jörg Stülke's lab
• for expression, purification of the RNA-binding domain in E. coli with N-terminal His-tag and thrombin cleavage site, in pGP570: pGP572, available in Jörg Stülke's lab

GFP fusion

• GP1225 (spc, based on pGP1870), available in Jörg Stülke's lab

FLAG-tag construct

• GP1221 (spc, based on pGP1331), available in Jörg Stülke's lab

Labs working on this gene/protein

• Stephane Aymerich, Microbiology and Molecular Genetics, INRA Paris-Grignon, France
• Josef Deutscher, Microbiology and Molecular Genetics, INRA Paris-Grignon, France

References

Reviews

Loading

Original publications

Loading